XB-IMG-153242
Xenbase Image ID: 153242
|
|
Supplemental figure 2: Detection of out-of-frame mutations induced by four other TALENs with a combination of X-gal staining and GFP fluorescence.
A) Diagram showing the strategy to clone a genomic DNA fragment encompassing the regions targeted by TALENs in Xenopus tropicalis. A TALEN for Xenopus tropicalis Sox3 (top) were custom-designed and assembled by Cellectis Bioresearch, Inc. (Cambridge, MA, USA) to target the region around the start codon of the gene as described in Material and Methods. The TALENs targeting Xenopus tropicalis TRα ligand binding domain (TRα-LBD), Dot1L (TALEN1 and TALEN2), respectively, were custom designed and assembled as previously described (Wen L and Shi Y-B, 2015, Endocrinology, 156(2):721–734; Wen et al., 2015, FASEB J, 29, 385– 393). The TRα- LBD left (TRα-LBD-L) arm recognizes the sequence TCCCCACTTCTGGCCC and the TRα-LBD right (TRα-LBD-L) arm recognizes the sequence TCATGCGCAGGTCCGTCACC in the TRα-LBD region. The Dot1L TALEN1 left (TALEN1-L) arm recognizes the sequence GAAAAACTCAACAA and the TALEN1 right (TALEN1-R) arm recognizes the sequence TCTCCATAGACCTCA in the Dot1L coding region. The Dot1L TALEN2 left (TALEN2-L) arm recognizes the sequence TACTGGTCTCCTTCGC and the TALEN2 right (TALEN2-R) arm recognizes the sequence TGTTACAGAGTGGTTGTAGAC in the Dot1L coding region. The TALEN mRNAs were synthesized in vitro and injected into fertilized eggs as described in the Materials and Methods. A pair of PCR primers (F and R) and a pair of nested PCR primers (NestedF, with an added BamHI recognition site at its 5’-end; and NestedR, with an added EcoR1 recognition site at its 5’-end) for each target region were designed for PCR amplification (see supplemental Table1) and subsequent cloning of the nested PCR fragment into pLacZα-GFP construct as described in the Materials and Methods. Note that the Dot1L TALEN1 and TALEN2 target adjacent region and share the F and R primers. The TRα-LBD TALENs (TALEN (LBD)) target the exon9, a region far away from the TRα TALENs targeting the DNA binding domain shown (TALEN(DBD) targets the exon3) which was analyzed in Fig.2, 3 and 5. Image published in: Fu L et al. (2016) Copyright © 2016, The Author(s). This image is reproduced with permission of the journal and the copyright holder. This is an open-access article distributed under the terms of the Creative Commons Attribution license Larger Image Printer Friendly View |