Xenbase Image ID: 170712

Supplementary Figure 8 Expression pattern of HSD10 mRNA. (A) The spatial expression pattern of HSD10 mRNA is shown by wholemount in situ hybridization. Signal is observed in early stages (NF5 to 10.5) and in tadpole stages (NF41) in ventral parts of the somites, neural tube, pronephros and eye. DIG-labelled antisense RNA as a probe for in situ hybridization was synthesized using Digoxygenin RNA labelling Kit (Roche) with pCS2+_myc/xHSD10 digested with SalI as a template. (B) The temporal expression pattern of HSD10 mRNA is shown by reverse transcription PCR analysis. cDNA for reverse transcription PCR was synthesized from total RNA of Xenopus embryos of different NF stages using Revert Aid M-MuLV RT (Fermentas). For the detection of HSD10, the following primer combinations and a standardized PCR protocol with 30 cycles and a T m of 56,3°C were used: HSD10 5’caccctgtcactgctctgaa3’ and 5’catcttggatttgcccaagt3’ and ODC 5’gtcaatgatggagtgtatggatc3’ and 5’tccattccgctctcctgagcac3’. Maternal mRNA for HSD10 exists until stage NF10.5, zygotic expression starts at stage NF19.5. Image published in: Rauschenberger K et al. (2010) Image downloaded from an Open Access article in PubMed Central. Copyright © 2010 EMBO Molecular Medicine Gene Synonyms Species Stage(s) Tissue hsd17b10.L abad, camr, erab, hadh2, hcd2, hsd10, mhbd, mrpp2, mrx17, mrx31, mrxs10, schad, sdr5c1 X. laevis Throughout NF stage 5 (16-cell) blastomere hsd17b10.L abad, camr, erab, hadh2, hcd2, hsd10, mhbd, mrpp2, mrx17, mrx31, mrxs10, schad, sdr5c1 X. laevis Throughout NF stage 10.5 animal hemisphere hsd17b10.L abad, camr, erab, hadh2, hcd2, hsd10, mhbd, mrpp2, mrx17, mrx31, mrxs10, schad, sdr5c1 X. laevis Throughout NF stage 12.5 ectoderm hsd17b10.L abad, camr, erab, hadh2, hcd2, hsd10, mhbd, mrpp2, mrx17, mrx31, mrxs10, schad, sdr5c1 X. laevis Throughout NF stage 19 neural plate hsd17b10.L abad, camr, erab, hadh2, hcd2, hsd10, mhbd, mrpp2, mrx17, mrx31, mrxs10, schad, sdr5c1 X. laevis Throughout NF stage 41 brain forebrain midbrain hindbrain pronephric kidney pronephric nephron pronephric tubule proximal tubule distal tubule pronephric duct Image source: Published Larger Image Printer Friendly View

Return to previous page