XB-IMG-170712
Xenbase Image ID: 170712
Supplementary Figure 8
Expression pattern of HSD10 mRNA. (A) The spatial expression pattern of HSD10 mRNA is shown by wholemount
in situ hybridization. Signal is observed in early stages (NF5 to 10.5) and in tadpole stages (NF41) in
ventral parts of the somites, neural tube, pronephros and eye. DIG-labelled antisense RNA as a probe for in situ
hybridization was synthesized using Digoxygenin RNA labelling Kit (Roche) with pCS2+_myc/xHSD10
digested with SalI as a template. (B) The temporal expression pattern of HSD10 mRNA is shown by reverse
transcription PCR analysis. cDNA for reverse transcription PCR was synthesized from total RNA of Xenopus
embryos of different NF stages using Revert Aid M-MuLV RT (Fermentas). For the detection of HSD10, the
following primer combinations and a standardized PCR protocol with 30 cycles and a T
m
of 56,3°C were used:
HSD10 5’caccctgtcactgctctgaa3’ and 5’catcttggatttgcccaagt3’ and ODC 5’gtcaatgatggagtgtatggatc3’ and
5’tccattccgctctcctgagcac3’. Maternal mRNA for HSD10 exists until stage NF10.5, zygotic expression starts at
stage NF19.5. Image published in: Rauschenberger K et al. (2010) Image downloaded from an Open Access article in PubMed Central. Copyright © 2010 EMBO Molecular Medicine
Image source: Published Larger Image Printer Friendly View |