XB-IMG-77160
Xenbase Image ID: 77160
|
Fig. S1. The shorter version of vpp1 transcripts is dominantly expressed during early embryonic development. (A) Schematic drawing showing two versions of exon/intron distribution caused by alternative splicing, which was drawn according to the information from the National Center for Biotechnology Information database for Xenopus tropicalis homologs of vpp1 gene. (B) Comparison of primary amino acid sequences of two vpp1 splicing variants. (C) RT-PCR analysis of developmental expression of the two vpp1 isoforms (GenBank accession nos.: JF439311, JF439312). The vpp1 primers used here are as follows: forward 5′CCAGACTTACTGAGGGTTCTG3′ and reverse 5′GGAGGAGGAGACAAAGGATTA3′. Odc was used as the loading control. Image published in: Zhao H et al. (2012) Copyright © 2012. Image reproduced with permission of the publisher and the copyright holder. This is an Open Access article distributed under the terms of the Creative Commons Attribution License. Larger Image Printer Friendly View |