XB-CLONE-2360176
|
Clone Name: cbfa2t3-751
|
Gene:
cbfa2t3.L
|
Species: Xenopus laevis
|
|
|
Description: EXRC Clone Number 751. Core-binding factor, runt domain, alpha subunit 2; translocated to, 3. Image EST 3399101. 99% identical to Image 5130002 at the nucleotide level. To generate probe for in situ.
Clone previously called: IMAGE:3399101
|
Sequence:
5' EST: BE576204
[+]
gagagacagtgtgaggctgggagccagaggagcagcaggcagctgggcatcgggacaaactgtaaggacgtttccagcgcgggaaccctgcattagcatc
caagctcaggatctttacattgggactgccactattttacccctcgtcttggtgtcgagggaccctattttcacattccgtcgcgagacctttatccttg
atttactacgaggaacttggaacggccgagtgatgtagggaggacagaagttgcggcacgggcacctggca
Library:
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.7 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.| Vector Details | Vector Map |
Name: pCMV-SPORT6
Type: phagemid
5' Restriction Site: NotI
3' Restriction Site: SalI |  |
Usage:
|
Whole mount in situ hybridization:
|
Expressed on VBI, Somite and Brain.
|
|
| |
|
Probes:
|
| Type |
Size |
Promoter |
Linearization Site |
Description |
| antisense |
|
T7 |
SmaI |
|
|
Suppliers:
Search for clone at:
EXRC