XB-CLONE-4280366
|
Clone Name: tubb2b-HAR52
|
Gene:
tubb2b
|
Species: Xenopus tropicalis
|
|
|
Description: EXRC Clone Number HAR-52.
Xenopus tropicalis tubulin, beta 2B class IIb. Tneu143I02 - AL798377 - 5' present
Note this clone is chimeric. The 5' end of this clone is the full length tropicalis neural specific tubulin (~1.7kb). However a portion (about 1.1kb) of 18S sequence is fused to the 3' end of the tubulin clone (same orientation). Therefore this clone is NOT suitable for in situs.
|
Sequence:
5' EST: AL798377
[+]
ccggccagacaccataggggtgtgcacaaaggggcaagtaacgcaacaagaaagggctacaacatccactgatttacaccgcttataagaccaataccaa
tcaatcgtaaccatgcgtgaaatcgtgcacatccatgctggccagtgcggtaaccaaattggagctaaattttgggaagtcatcagtgatgaacacggga
ttgatcctacaggcagttaccatggagacagtgatttgcaactagaaaggatcaacgtatattacaatgaagccacaggtgacaaatttgtaccccgtgc
catccttgtggatttggaaccaggcacaatggattctgtcagatctgggccattcgggcagattttcagaccagacaactttgtctttggtcagagtggt
gctggcaataactgggccaagggtcattacacggaaagagctgagctggtggactctgttctggatgtggtgagaaaagaagcagagagctgtgactgcc
tacaaagttttcagttgacccattctct
Library:
Description: cDNA was oligo dT primed from 5ug of poly A+ RNA from neurula. EcoRI-NotI cut cDNA was then ligated into pCS107 with EcoRI at the 5' end and NotI at the 3' end.| Vector Details | Vector Map |
Name: pCS107
Type: plasmid
5' Restriction Site: EcoRI
3' Restriction Site: NotI |  |
Usage:
|
Whole mount in situ hybridization:
|
|
|
| |
|
Probes:
|
| Type |
Size |
Promoter |
Linearization Site |
Description |
| antisense |
|
T7 |
EcoRI |
|
|
Suppliers:
Search for clone at:
EXRC