Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-CLONE-1557476

Clone Name: gfi1-858 Gene: gfi1.S Species: Xenopus laevis  
Description: EXRC Clone Number 858. Xenopus laevis growth factor independent 1 transcription repressor. Image EST 8547327. To generate probe for in situ.

Sequence:

5' EST: EB645267 [+]

Library:

Name: NICHD_XGC_thyExternal Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library

Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: thymusStage:
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pCS111

Type: plasmid

5' Restriction Site: SmaI

3' Restriction Site: NotI
Expression Image

Usage:

Whole mount in situ hybridization: Expressed on Blood, DA, myeloid and VBI.  
 
Probes:
Type Size Promoter Linearization Site Description
antisense T7 ClaI EcoRI can also be used.


Suppliers:

Search for clone at: EXRC

Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556