Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-CLONE-1653083

Clone Name: pax3-863 Gene: pax3.S Species: Xenopus laevis  
Description: EXRC Clone Number 863. Xenopus laevis paired box 3. Image EST 7981250, Accession BC108573 (full length). To generate probe for in situ.

Sequence:

Full length sequence: BC108573 [+]

5' EST: DR721264 [+]

3' EST: DR721243 [+]

Library:

Name: NICHD_XGC_Emb10External Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library

Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 1.8kb. This is a normalized library (primary library is NICHD_XGC_Emb9) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: whole organismStage: NF stage 17 to NF stage 19
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pExpress-1

Type: plasmid

5' Restriction Site: EcoRV

3' Restriction Site: NotI		Expression Image

Usage:

Whole mount in situ hybridization:  
 
Probes:
Type Size Promoter Linearization Site Description
antisense T7 SmaI

Suppliers:

Search for clone at: EXRC