Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions

Clone Name: ankrd1-906 Gene: ankrd1.L Species: Xenopus laevis  
Description: EXRC Clone Number 906. Xenopus laevis Ankyrin repeat domain 1 (cardiac muscle). 100% identical to image 6939850, Accession AAH99339. To generate probe for in situ. Clone previously called IMAGE:8742166.


5' EST: EE317672 [+]


Name: NICHD_XGC_boneExternal Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library

Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.65 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: bone tissueStage:
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pCS111

Type: plasmid

5' Restriction Site: SmaI

3' Restriction Site: NotI
Expression Image


Whole mount in situ hybridization: Expressed on Heart.  
Type Size Promoter Linearization Site Description
antisense T7 BamHI


Search for clone at: EXRC

Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1

Major funding for Xenbase is provided by grant P41 HD064556