XB-CLONE-1561297
Sequence:5' EST: EB483438 |
|||||||||||||||||||||||||||
| Name: NICHD_XGC_olfb | External Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library |
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.25 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
| Anatomy: brain | Stage: unspecified stage |
| Normalized: No | Subtraction: No |
| Vector Details | Vector Map | Name: pCS111 Type: plasmid 5' Restriction Site: SmaI 3' Restriction Site: NotI |
Usage:
Suppliers:
Search for clone at: open biosystems geneservice/RZPD imagenes
