Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions

Clone Name: emilin2-876 Gene: emilin2.L , emilin2.S Species: Xenopus laevis  
Description: EXRC Clone Number 876. Elastin microfibril interfacer 2 [Predicted: Source is Human Entrez Gene]. To generate probe for in situ. Clone previously called: IMAGE:8072697


Full length sequence: BC127409 [+]

5' EST: DT081724 [+]

Unigene: Xl.54190


Name: NICHD_XGC_FaBExternal Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library

Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.2kb resulted in an average insert size of 1.8kb. This is a primary library (normalized library is NICHD_XGC_FaBN) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: fat bodyStage:
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pExpress-1

Type: plasmid

5' Restriction Site: EcoRV

3' Restriction Site: NotI
Expression Image


Whole mount in situ hybridization: Expressed on Blood and Myeloid.  


Search for clone at: EXRC

Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0

Major funding for Xenbase is provided by grant P41 HD064556