Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions

Clone Name: tbx1-860 Gene: tbx1.L Species: Xenopus laevis  
Description: EXRC Clone Number 860. Xenopus laevis T-box 1. Image EST 7206683, Accession BC108602. Full length. To generate probe for in situ.


Full length sequence: BC108602 [+]

5' EST: CK798689 [+]

Unigene: Xl.51448 , Xl.85545


Name: NICHD_XGC_Te2NExternal Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library

Description: RNA obtained from 6 adult male testes. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.15 kb. This primary, microquantity library is normalized to Cot5 (non-normalized primary library is NICHD_XGC_Te2) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: testisStage:
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pExpress-1

Type: plasmid

5' Restriction Site: EcoRV

3' Restriction Site: NotI
Expression Image


Whole mount in situ hybridization: Expressed in branchial arches.  
Type Size Promoter Linearization Site Description
antisense T7 SacII


Search for clone at: EXRC

Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556