Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Expression Attributions
XB-CLONE-1822350

Clone Name: IMAGE:7206195 Gene: uros.L Species: Xenopus laevis  
Description: EXRC Clone Number 767. Heme biosynthesis enzyme Xenopus laevis uroporphyrinogen III synthase (uros), mRNA. To generate probe for in situ.

Sequence:

Full length sequence: BC087535 [+]

5' EST: CK796697 [+]

Unigene: Xl.49923


Library:

Name: NICHD_XGC_Te2NExternal Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library

Description: RNA obtained from 6 adult male testes. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.15 kb. This primary, microquantity library is normalized to Cot5 (non-normalized primary library is NICHD_XGC_Te2) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: testisStage: frog
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pExpress-1

Type: plasmid

5' Restriction Site: EcoRV

3' Restriction Site: NotI
Expression Image

Usage:

Whole mount in situ hybridization: Expressed on VBI.  


Suppliers:

Search for clone at: EXRC

My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556