My Xenbase
[Login] [Register]
Summary Expression Attributions
XB-CLONE-2439171

Clone Name: IMAGE:8845922 Gene: ube2j1 Species: Xenopus tropicalis  
 

Sequence:

5' EST: ES677445 [+]

3' EST: ES677446 [+]

Unigene: Str.1705


Library:

Name: NICHD_XGC_tropEye1External Dbs: Unigene tropicalis cDNA library, Xenopus IMAGE cDNA Library

Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.2kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: eyeStage: frog
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pCS111

Type: plasmid

5' Restriction Site: SmaI

3' Restriction Site: NotI
Expression Image

Usage:


Suppliers:

Search for clone at: open biosystems geneservice/RZPD imagenes