On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-CLONE-2440261

Clone Name: IMAGE:8845599 Gene: vim Species: Xenopus tropicalis  
 

Sequence:

5' EST: ES676824 [+]

Unigene: Str.43578


Library:

Name: NICHD_XGC_tropEye1External Dbs: Unigene tropicalis cDNA library, Xenopus IMAGE cDNA Library

Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.2kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: eyeStage: frog
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pCS111

Type: plasmid

5' Restriction Site: SmaI

3' Restriction Site: NotI
Expression Image

Usage:


Suppliers:

Search for clone at: Open Biosystems Source BioScience

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556