Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions

Clone Name: IMAGE:8963891 Gene: dlst Species: Xenopus tropicalis  


5' EST: EL655774 [+]


Name: NICHD_XGC_tropInt_66External Dbs: Unigene tropicalis cDNA library, Xenopus IMAGE cDNA Library

Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: intestineStage: unspecified stage
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pCS111

Type: plasmid

5' Restriction Site: SmaI

3' Restriction Site: NotI
Expression Image



Search for clone at: Open Biosystems Source BioScience

Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556