My Xenbase
[Login] [Register]
Search
For
Summary Genes Attributions
XB-LIB-135

Library Name: RT-PCR product from stage 20 RNA

Species: Xenopus laevis

Number Of Clones: 1

Description: RT-PCR product was generated from Xenopus stage 20 RNA using the primers:-5' AGAGCCCAGAATGAAAATGC; 3' TGAAAGGAGAAAGCCATAGG

Normalized: No Subtraction: No
Anatomy: whole organism Stage: NF stage 20

Reporting Bugs  Contact Us  Need Help?  Citing Xenbase  About Xenbase  About Xenopus 

Supported by NICHD P41 HD064556

A Xenopus laevis and tropicalis resource  ©Xenbase 2005-2013