Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Genes Attributions

Library Name: NICHD_XGC_FaBN

Species: Xenopus laevis

Number Of Clones: 4720

Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.2kb resulted in an average insert size of 1.5kb, and Cot value of 7. This is a normalized library (primary library is NICHD_XGC_FaB) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Normalized: No Subtraction: No
Anatomy: fat body Stage:

Vector DetailsVector Map
Name: pExpress-1

Type: plasmid

5' Restriction Site: EcoRV

3' Restriction Site: NotI
Expression Image
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.8.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556