|
XB-LIB-165
Library Name: NICHD_XGC_olfb
|
Species: Xenopus laevis
|
Number Of Clones: 4011
|
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.25 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
| Vector Details | Vector Map | Name: pCS111
Type: plasmid
5' Restriction Site: SmaI
3' Restriction Site: NotI |  |
|
[2.8.5]
