|
XB-LIB-167
Library Name: NICHD_XGC_limb
|
Species: Xenopus laevis
|
Number Of Clones: 4154
|
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >900 bp resulted in an average insert size of 1.1 kb. This primary library was constructed by Express Genomics (Frederick, MD). Use M13(-21) primer for 3' end reads, and m13rp for 5' end reads. Note: this is a Xenopus Gene Collection library.
|
Normalized: No
|
Subtraction: No
|
|
Anatomy:
limb
|
Stage:
|
| Vector Details | Vector Map | Name: pCS111
Type: plasmid
5' Restriction Site: SmaI
3' Restriction Site: NotI |  |
|
[2.8.5]
