Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Genes Attributions

Library Name: NICHD_XGC_skin_m

Species: Xenopus laevis

Number Of Clones: 4302

Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >900 bp resulted in an average insert size of 1.2 kb. This primary library was constructed by Express Genomics (Frederick, MD). Use M13(-21) primer for 3' end reads and m13rp for 5' reads. Note: this is a Xenopus Gene Collection library.

Normalized: No Subtraction: No
Anatomy: skin Stage: unspecified stage

Vector DetailsVector Map
Name: pCS111

Type: plasmid

5' Restriction Site: SmaI

3' Restriction Site: NotI
Expression Image
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1

Major funding for Xenbase is provided by grant P41 HD064556