Please note upcoming maintenance times for Xenbase - times are EST:

Wednesday 12-Dec-2018 before noon: BLAST, FTP (Xenbase will be partially functional)
Thursday 13-Dec-2018 before noon: Wiki, GBrowse, JBrowse (Xenbase will be partially functional)
Friday 14-Dec-2018 starting at 5 pm through weekend: Xenbase site and database (Xenbase will be completely down)

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Genes Attributions
XB-LIB-168

Library Name: NICHD_XGC_skin_m

Species: Xenopus laevis

Number Of Clones: 4302



Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >900 bp resulted in an average insert size of 1.2 kb. This primary library was constructed by Express Genomics (Frederick, MD). Use M13(-21) primer for 3' end reads and m13rp for 5' reads. Note: this is a Xenopus Gene Collection library.

Normalized: No Subtraction: No
Anatomy: skin Stage: unspecified stage

Vector DetailsVector Map
Name: pCS111

Type: plasmid

5' Restriction Site: SmaI

3' Restriction Site: NotI
Expression Image
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.0


Major funding for Xenbase is provided by grant P41 HD064556