Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Welcome to the miRNA catalog.

miRNAs are small, non-coding RNAs that play a role in regulating gene expression. The data here contains miRNA in situ expression in xenopus embryos. The data and images is supplied courtesy of Grant Wheeler and Mike Gilchrist's XenMARK. The miRNAs have been correlated with miRBase xenopus miRNAs to provide more information. Click the miRNA links to view more information about the miRNA, including in situ images.
miRNA In Situ Mature Sequence Stage Range miRBase link
xla-miR-1306 ACGUUGGCUCUGGUGGUG 28-35 MI0008374
xla-miR-427 AAAGUGCUUUCUGUUUUGGGCG 28-29 MI0001449
xla-miR-429 UAAUACUGUCUGGUAAUGCC 28-35 MI0001451
xla-miR-703 AAAACCUUCAGAAGGAAAGAA 28-36 MI0008386
xtr-let-7a UGAGGUAGUAGGUUGUAUAGUU 28-36 MI0004908
xtr-let-7b UGAGGUAGUAGUUUGUGUAGUU 28-35 MI0004787
xtr-let-7c UGAGGUAGUAGGUUGUAUGGUU 26-35 MI0004886
xtr-let-7f UGAGGUAGUAGAUUGUAUAGUU 24-35 MI0004887
xtr-let-7g UGAGGUAGUUGUUUGUACAGU 15-32 MI0004888
xtr-let-7i UGAGGUAGUAGUUUGUGCUGU 10-32 MI0004889
xtr-miR-100 AACCCGUAGAUCCGAACUUGUG 42-42 MI0004927
xtr-miR-10b UACCCUGUAGAACCGAAUUUGU 17-28 MI0004797
xtr-miR-10c CACCCUGUAGAAUCGAAUUUGU 28-36 MI0004798
xtr-miR-124 UUAAGGCACGCGGUGAAUGCCA 26-26 MI0004930
xtr-miR-125a UCCCUGAGACCCUUAACCUGUG 27-28 MI0004931
xtr-miR-126 UCGUACCGUGAGUAAUAAUGC 28-42 MI0004827
xtr-miR-126* CAUUAUUACUUUUGGUACGCG 28-28 MI0004827
xtr-miR-130a CAGUGCAAUGUUAAAAGGGCAU 28-36 MI0004831
xtr-miR-130b CAGUGCAAUGAUGAAAGGGCAU 28-36 MI0004833
xtr-miR-130c CAGUGCAAUAUUAAAAGGGCAU 29-36 MI0004832
xtr-miR-132 UAACAGUCUACAGCCAUGGUCG 30-42 MI0004834
xtr-miR-133a UUGGUCCCCUUCAACCAGCUGU 29-42 MI0004962
xtr-miR-133b UUGGUCCCCUUCAACCAGCUA 26-35 MI0004837
xtr-miR-133c UUGGUCCCCUUCAACCAGCUGC 30-30 MI0004835
xtr-miR-133d UUGGUCCCCUUCAACCAGCCGC 30-42 MI0004836
xtr-miR-138 AGCUGGUGUUGUGAAUC 31-36 MI0004839
xtr-miR-139 UCUACAGUGCAUGUGUCU 28-42 MI0004840
xtr-miR-140-3p CCGUGGUUCUACCCGUGGU 28-36
xtr-miR-143 UGAGAUGAAGCACUGUAGCUCG 30-30 MI0004937
xtr-miR-144 UACAGUAUAGAUGAUGUACUAC 28-36 MI0004938
xtr-miR-146b UGAGAACUGAAUUCCAUGGACU 30-37 MI0006265
xtr-miR-148a UCAGUGCACUACAGAACUUUGU 20-28 MI0004905
xtr-miR-148b UCAGUGCAUCACAGAACUUUGU 20-25 MI0004845
xtr-miR-150 UCUCCCAACCCUUGUACCAGAG 11-11 MI0004846
xtr-miR-155 UUAAUGCUAAUCGUGAUAGGG 11-18 MI0004848
xtr-miR-15a UAGCAGCACAUAAUGGUUUGUG 24-26 MI0004799
xtr-miR-15b UAGCAGCACAUCAUGAUUUGCA 10.5-17 MI0004800
xtr-miR-15c UAGCAGCACAUCAUGGUUUGUA 15-25 MI0004892
xtr-miR-16a UAGCAGCACGUAAAUAUUGGUG 16-28 MI0004802
xtr-miR-16b UAGCAGCACGUAAAUAUUGGGU 16-26 MI0004910
xtr-miR-16c UAGCAGCACGUAAAUACUGGAG 26-36 MI0004801
xtr-miR-181a-1* ACCAUCGAUCGUUGACUGUACA 18-30 MI0004865
xtr-miR-181a-2* ACCAUCGGCCGUUGACUGUACC 18-29 MI0004866
xtr-miR-182 UUUGGCAAUGGUAGAACUCACA 11-16 MI0004851
xtr-miR-182* UGGUUCUAGACUUGCCAACUA 11-11 MI0004851
xtr-miR-184 UGGACGGAGAACUGAUAAGGCU 18-24 MI0004853
xtr-miR-187 UCGUGUCUUGUGUUGCAGCCA 20-22 MI0004854
xtr-miR-18a* ACUGCCCUAAGUGCUCCUUCU 24-32 MI0004893
xtr-miR-191 CAACGGAAUCCCAAAAGCAGC 21-29 MI0004941
xtr-miR-192 AUGACCUAUGAAUUGACAGCC 18-29 MI0004855
xtr-miR-196a UAGGUAGUUUCAUGUUGUUG 18-22 MI0004942
xtr-miR-196b UAGGUAGUUUUAUGUUGUUGG 18-22 MI0004943
xtr-miR-199a CCCAGUGUUCAGACUACCUGUUC 18-28 MI0004859
xtr-miR-199b CCCAGUGUUCAGACUACGUGUUC 18-19 MI0004944
xtr-miR-1b UGGAAUGUUAAGAAGUAUGUA 26-36 MI0004890
xtr-miR-200a UAACACUGUCUGGUAACGAUGU 32-32 MI0004945
xtr-miR-202* AAAGAGGUAUAUGCAUAGGAAA 18-18 MI0004860
xtr-miR-203 GUGAAAUGUUUAGGACCACUUG 11-11 MI0004947
xtr-miR-205a UCCUUCAUUCCACCGGAGUCUG 19-26 MI0004950
xtr-miR-205b UCCUUCAUUCCACCGGAUCCUG 18-18 MI0004862
xtr-miR-206 UGGAAUGUAAGGAAGUGUGUGG 13-16 MI0004863
xtr-miR-208 AUAAGACGAGCAUAAAGCUUGU 16-26 MI0004951
xtr-miR-20b ACUGCAUAAUGAGCACUUAAA 32-36 MI0004961
xtr-miR-210 CUGUGCGUGUGACAGCGGCUAA 17-20 MI0004864
xtr-miR-212 UAACAGUCUACAGUCAUGGCU 18-28 MI0004952
xtr-miR-214 ACAGCAGGCACAGACAGGCAG 11-17 MI0004867
xtr-miR-215 AUGACCUAUGAAAUGACAGCC 18-20 MI0004868
xtr-miR-216 UAAUCUCAGCUGGCAACUGU 20-28 MI0004869
xtr-miR-2184 AACAGUAAGAGAUUAUGUGCUG 18-28 MI0011553
xtr-miR-2188 AAGGUCCAGCCUCAUAUGUCCU 11-18 MI0011554
xtr-miR-219 UGAUUGUCCAAACGCAAUUCU 17-23 MI0004873
xtr-miR-223 UGUCAGUUUGUCAAAUACCC 26-40 MI0004875
xtr-miR-23b AUCACAUUGCCAGGGAUUACCA 26-36 MI0004913
xtr-miR-24a UGGCUCAGUUCAGCAGGAACAG 26-36 MI0004895
xtr-miR-27a UUCACAGUGGCUAAGUUCCGC 26-40 MI0004809
xtr-miR-27b UUCACAGUGGCUAAGUUCUGC 30-32 MI0004810
xtr-miR-29a UAGCACCAUUUGAAAUCGGUU 28-40 MI0004897
xtr-miR-29c* UGACCGAUCUCUCUUGGUGUUC 23-28 MI0004918
xtr-miR-30b UGUAAACAUCCUACACUCAGCU 28-40 MI0004814
xtr-miR-30d UGUAAACAUCCCCGACUGGAAG 29-40 MI0004898
xtr-miR-30e UGUAAACAUCCUUGACUGGAAG 28-40 MI0004920
xtr-miR-31b GGCAAGAUGCUGGCAAGCU 28-40 MI0006264
xtr-miR-320 AAAAGCUGGGUUGAGAGGUGA 24-38 MI0006266
xtr-miR-33a GUGCAUUGUAGUUGCAUUG 28-40 MI0004922
xtr-miR-33b GUGCAUUGUUGUUGCAUUG 28-40 MI0004923
xtr-miR-367 AAUUGCACUGUAGCAAUGGUGA 17-18 MI0004880
xtr-miR-375 UUUGUUCGUUCGGCUCGCGUUA 24-38 MI0006267
xtr-miR-428 UAAGUGCUCUCUAGUUCGGUUG 27-27 MI0004963
xtr-miR-429 UAAUACUGUCUGGUAAUGCCGU 10-10 MI0004956
xtr-miR-455 UAUGUGCCCUUGGACUACAUCG 10-12 MI0004883
xtr-miR-9* UAAAGCUAGAUAACCGAAAGU 24-36 MI0004793
xtr-miR-92b UAUUGCACUCGUCCCGGCCU 28-37 MI0004899
xtr-miR-93a AAAGUGCUGUUCGUGCAGGUAG 28-40 MI0004900
xtr-miR-9b* UAAAGCUAGACAACCGAACGU 23-36 MI0004795
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1

Major funding for Xenbase is provided by grant P41 HD064556