Please note upcoming maintenance times for Xenbase - times are EST:

Wednesday 12-Dec-2018 before noon: BLAST, FTP (Xenbase will be partially functional)
Thursday 13-Dec-2018 before noon: Wiki, GBrowse, JBrowse (Xenbase will be partially functional)
Friday 14-Dec-2018 starting at 5 pm through weekend: Xenbase site and database (Xenbase will be completely down)

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: rsy-miR-21
Mature Sequence: UCAACAUCAGUCUGAUAAGCUA
Full Sequence:
Mirbase:
In Situ Images:

NF Stage 45

Cited Literature:
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.0


Major funding for Xenbase is provided by grant P41 HD064556