Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xla-miR-220c
Mature Sequence: CUACCACUGUAUCAGACACCUU
Full Sequence:
Mirbase:
In Situ Images:

NF Stage 28

NF Stage 29

NF Stage 35

Cited Literature:

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556