Please note upcoming maintenance times for Xenbase - times are EST:

Wednesday 12-Dec-2018 before noon: BLAST, FTP (Xenbase will be partially functional)
Thursday 13-Dec-2018 before noon: Wiki, GBrowse, JBrowse (Xenbase will be partially functional)
Friday 14-Dec-2018 starting at 5 pm through weekend: Xenbase site and database (Xenbase will be completely down)

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xla-miR-427
Mature Sequence: AAAGUGCUUUCUGUUUUGGGCG
Full Sequence:
AGCACCCAAA ACGGGGCUCU CUCUUGUGAC UGAAUUAUGA UGAGAAAGUG CUUUCUGUUU
Mirbase: MI0001449
In Situ Images:

NF Stage 28

NF Stage 29

NF Stage 35

Cited Literature:
The miR-430/427/302 family controls mesendodermal fate specification via species-specific target selection.
Rosa A et al. 2009
Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis.
Armisen J et al. 2009
Limiting Ago protein restricts RNAi and microRNA biogenesis during early development in Xenopus laevis.
Lund E et al. 2011
Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs.
Lund E et al. 2006
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008
Deadenylation of maternal mRNAs mediated by miR-427 in Xenopus laevis embryos.
Lund E et al. 2009
RNAi in Xenopus: look before you leap.
Flynt AS et al. 2011
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.0


Major funding for Xenbase is provided by grant P41 HD064556