Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xla-miR-703
Mature Sequence: AAAACCUUCAGAAGGAAAGAA
Full Sequence:
AGACUGGUUA AUGAUAACAA UGCAUCGUAA AACCUUCAGA AGGAAAGAAU GUUGUGGACC AUUUUUUUUG UGUGUGGCAG UUUUAAGUUA UUAGUUUUCA
miRBase: MI0008386
In Situ Images:

NF Stage 28

NF Stage 36

NF Stage 36

Cited Literature:
Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556