Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-let-7i
Mature Sequence: UGAGGUAGUAGUUUGUGCUGU
Full Sequence:
CUGGCUGAGG UAGUAGUUUG UGCUGUUGGU CGGGUUGUGA CACUGCCCGC UGUGGAGAUA ACUGCGCAAG CUACUGCCUU
Mirbase: MI0004889
In Situ Images:

NF Stage 10

NF Stage 32

NF Stage 36

Cited Literature:
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556