On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-10a
Mature Sequence: UACCCUGUAGAUCCGAAUUUGUG
Full Sequence:
GAUUUGCCUG UCCUCUGUAU GUACCCUGUA GAUCCGAAUU UGUGUGAGCG CAAUCAUAUC ACAAAUUCGU GUCUGGGGGG AUAUGCAGUU GACACAAACG
Mirbase: MI0004796
In Situ Images:

NF Stage 24

NF Stage 26

NF Stage 28

NF Stage 35

NF Stage 36

NF Stage 45

NF Stage 45

Cited Literature:

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556