Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-10b
Mature Sequence: UACCCUGUAGAACCGAAUUUGU
Full Sequence:
AACGUUGUCU AUAUGUACCC UGUAGAACCG AAUUUGUGUG GUUCGUACAG UCACAGAUUC GAUUCUAGGG GGAUAUAUGG
Mirbase: MI0004797
In Situ Images:

NF Stage 17

NF Stage 28

NF Stage 28

NF Stage 36

NF Stage 36

NF Stage 36

NF Stage 45

NF Stage 8

NF Stage 8

NF Stage 8

NF Stage 8

NF Stage 8

NF Stage 8

NF Stage 8

NF Stage 8

Cited Literature:
Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis.
Armisen J et al. 2009
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556