Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-122
Mature Sequence: UGGAGUGUGACAAUGGUGUUUGU
Full Sequence:
GAGCUAUGGA GUGUGACAAU GGUGUUUGUG UCAGAGCUAU CAAACGCCAU UAUCACACUA
Mirbase: MI0004824
In Situ Images:

NF Stage 28

NF Stage 30

NF Stage 35

NF Stage 42

NF Stage 45

Cited Literature:
Interaction of eIF4G with poly(A)-binding protein stimulates translation and is critical for Xenopus oocyte maturation.
Wakiyama M et al. 2000
Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis.
Armisen J et al. 2009

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556