Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-124
Mature Sequence: UUAAGGCACGCGGUGAAUGCCA
Full Sequence:
UAAGUCUCUG ACUCUCCGUG UUCACAGCGG ACCUUGAUUU AAUGUCAUAC AAUUAAGGCA CGCGGUGAAU GCCAAGAGUG
Mirbase: MI0004930
In Situ Images:

NF Stage 26

NF Stage 26

NF Stage 28

NF Stage 28

NF Stage 35

NF Stage 35

NF Stage 36

Cited Literature:
MicroRNAs couple cell fate and developmental timing in retina.
Decembrini S et al. 2009
Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs.
Lim LP et al. 2005
FMR1/FXR1 and the miRNA pathway are required for eye and neural crest development.
Gessert S et al. 2010
MiR-124 regulates early neurogenesis in the optic vesicle and forebrain, targeting NeuroD1.
Liu K et al. 2011
MicroRNA miR-124 regulates neurite outgrowth during neuronal differentiation.
Yu JY et al. 2008
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556