Please note upcoming maintenance times for Xenbase - times are EST:

Wednesday 12-Dec-2018 before noon: BLAST, FTP (Xenbase will be partially functional)
Thursday 13-Dec-2018 before noon: Wiki, GBrowse, JBrowse (Xenbase will be partially functional)
Friday 14-Dec-2018 starting at 5 pm through weekend: Xenbase site and database (Xenbase will be completely down)

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-124
Mature Sequence: UUAAGGCACGCGGUGAAUGCCA
Full Sequence:
UAAGUCUCUG ACUCUCCGUG UUCACAGCGG ACCUUGAUUU AAUGUCAUAC AAUUAAGGCA CGCGGUGAAU GCCAAGAGUG
Mirbase: MI0004930
In Situ Images:

NF Stage 26

NF Stage 26

NF Stage 28

NF Stage 28

NF Stage 35

NF Stage 35

NF Stage 36

Cited Literature:
MicroRNAs couple cell fate and developmental timing in retina.
Decembrini S et al. 2009
Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs.
Lim LP et al. 2005
FMR1/FXR1 and the miRNA pathway are required for eye and neural crest development.
Gessert S et al. 2010
MiR-124 regulates early neurogenesis in the optic vesicle and forebrain, targeting NeuroD1.
Liu K et al. 2011
MicroRNA miR-124 regulates neurite outgrowth during neuronal differentiation.
Yu JY et al. 2008
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.0


Major funding for Xenbase is provided by grant P41 HD064556