On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-125b
Mature Sequence: UCCCUGAGACCCUAACUUGUGA
Full Sequence:
Mirbase:
In Situ Images:

NF Stage 28

NF Stage 35

NF Stage 42

NF Stage 42

Cited Literature:
Testis-derived microRNA profiles of African clawed frogs (Xenopus) and their sterile hybrids.
Michalak P et al. 2008
miR-31 functions as a negative regulator of lymphatic vascular lineage-specific differentiation in vitro and vascular development in vivo.
Karpanen T et al. 2010

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556