On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-126
Mature Sequence: UCGUACCGUGAGUAAUAAUGC
Full Sequence:
GGCUGUGCAU UAUUACUUUU GGUACGCGCU GUGUCACAUC AAACUCGUAC CGUGAGUAAU
Mirbase: MI0004827
In Situ Images:

NF Stage 28

NF Stage 42

NF Stage 45

NF Stage 45

NF Stage 45

NF Stage 45

NF Stage 45

Cited Literature:
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556