On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-128
Mature Sequence: UCACAGUGAACCGGUCUCUUUU
Full Sequence:
Mirbase:
In Situ Images:

NF Stage 29

NF Stage 36

NF Stage 42

NF Stage 42

Cited Literature:
Identification and expression-profiling of Xenopus tropicalis miRNAs including plant miRNA-like RNAs at metamorphosis.
et al. 2007
Identification of a microRNA that activates gene expression by repressing nonsense-mediated RNA decay.
Bruno IG et al. 2011

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556