Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-133a
Mature Sequence: UUGGUCCCCUUCAACCAGCUGU
Full Sequence:
CAAUGCUUUG CUAAAGCUGG UAAAAUGGAA CCAAAUCACC UCUUCAAUGG AUUUGGUCCC CUUCAACCAG CUGUAGGAUU
Mirbase: MI0004962
In Situ Images:

NF Stage 29

NF Stage 42

Cited Literature:
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005
Identification and expression-profiling of Xenopus tropicalis miRNAs including plant miRNA-like RNAs at metamorphosis.
et al. 2007

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556