Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-133b
Mature Sequence: UUGGUCCCCUUCAACCAGCUA
Full Sequence:
CUGCUAUGGC UGGUCAAACG GAACCAAGUC CGUCUUCCUU AGAGGUUUGG UCCCCUUCAA CCAGCUAUUG
Mirbase: MI0004837
In Situ Images:

NF Stage 26

NF Stage 35

NF Stage 42

NF Stage 42

NF Stage 8

NF Stage 8

NF Stage 8

Cited Literature:
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005
microRNA-24a is required to repress apoptosis in the developing neural retina.
Walker JC et al. 2009
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556