On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-133b
Mature Sequence: UUGGUCCCCUUCAACCAGCUA
Full Sequence:
CUGCUAUGGC UGGUCAAACG GAACCAAGUC CGUCUUCCUU AGAGGUUUGG UCCCCUUCAA CCAGCUAUUG
Mirbase: MI0004837
In Situ Images:

NF Stage 26

NF Stage 35

NF Stage 42

NF Stage 42

NF Stage 8

NF Stage 8

NF Stage 8

Cited Literature:
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005
microRNA-24a is required to repress apoptosis in the developing neural retina.
Walker JC et al. 2009

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556