Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-135
Mature Sequence: UAUGGCUUUUUAUUCCUAUGUGA
Full Sequence:
Mirbase:
In Situ Images:

NF Stage 28

NF Stage 36

NF Stage 42

Cited Literature:
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.0


Major funding for Xenbase is provided by grant P41 HD064556