On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-146b
Mature Sequence: UGAGAACUGAAUUCCAUGGACU
Full Sequence:
CCAAUGGCAG GGCCCGGCUC UGAGAACUGA AUUCCAUGGA CUGUUCCACU CACAGCACCC UCAGUCCACA GUGUUCAGUG CUCCAGUCUG GCUGCCACUA
Mirbase: MI0006265
In Situ Images:

NF Stage 30

NF Stage 37

Cited Literature:
Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis.
Armisen J et al. 2009

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556