Please note upcoming maintenance times for Xenbase - times are EST:

Wednesday 12-Dec-2018 before noon: BLAST, FTP (Xenbase will be partially functional)
Thursday 13-Dec-2018 before noon: Wiki, GBrowse, JBrowse (Xenbase will be partially functional)
Friday 14-Dec-2018 starting at 5 pm through weekend: Xenbase site and database (Xenbase will be completely down)

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-148a
Mature Sequence: UCAGUGCACUACAGAACUUUGU
Full Sequence:
UAGUCUUUUA AAUCAAAGUU CUGUGACACU UAGACUCUGA AUAUGAUAGC AGUCAGUGCA CUACAGAACU UUGUUUUGGG
Mirbase: MI0004905
In Situ Images:

NF Stage 20

NF Stage 28

NF Stage 30

NF Stage 36

NF Stage 36

NF Stage 8

NF Stage 8

NF Stage 8

NF Stage 8

Cited Literature:
miR-31 functions as a negative regulator of lymphatic vascular lineage-specific differentiation in vitro and vascular development in vivo.
Karpanen T et al. 2010
Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis.
Armisen J et al. 2009
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.0


Major funding for Xenbase is provided by grant P41 HD064556