Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-148a
Mature Sequence: UCAGUGCACUACAGAACUUUGU
Full Sequence:
UAGUCUUUUA AAUCAAAGUU CUGUGACACU UAGACUCUGA AUAUGAUAGC AGUCAGUGCA CUACAGAACU UUGUUUUGGG
Mirbase: MI0004905
In Situ Images:

NF Stage 20

NF Stage 28

NF Stage 30

NF Stage 36

NF Stage 36

NF Stage 8

NF Stage 8

NF Stage 8

NF Stage 8

Cited Literature:
miR-31 functions as a negative regulator of lymphatic vascular lineage-specific differentiation in vitro and vascular development in vivo.
Karpanen T et al. 2010
Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis.
Armisen J et al. 2009

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556