Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-148b
Mature Sequence: UCAGUGCAUCACAGAACUUUGU
Full Sequence:
UGAGGAACAG CGUUUGAGGU GAAGUUCUGU UAUACACUCC GGCUGUGAGU AAGUGGAAGU CAGUGCAUCA CAGAACUUUG UCUCGAGGGC
Mirbase: MI0004845
In Situ Images:

NF Stage 20

NF Stage 25

NF Stage 28

NF Stage 31

NF Stage 35

NF Stage 43

Cited Literature:
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.8.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556