Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-15b
Mature Sequence: UAGCAGCACAUCAUGAUUUGCA
Full Sequence:
UGUCCUAAAG AAGUGUAGCA GCACAUCAUG AUUUGCAUGC UGUAUUAUAG AUUCUAAUCA UUUUUUGCUG CUUCAUGAUA
Mirbase: MI0004800
In Situ Images:

NF Stage 10.5

NF Stage 17

NF Stage 28

NF Stage 36

NF Stage 36

NF Stage 37

NF Stage 45

NF Stage 8

NF Stage 8

NF Stage 8

NF Stage 8

NF Stage 8

NF Stage 8

Cited Literature:
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008
MicroRNA control of Nodal signalling.
Martello G et al. 2007
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556