Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-15c
Mature Sequence: UAGCAGCACAUCAUGGUUUGUA
Full Sequence:
CUUUGAGGUG AUCUAGCAGC ACAUCAUGGU UUGUAGAAAC AAGGAGAUAC AGACCAUUCU GAGCUGCCUC
miRBase: MI0004892
In Situ Images:

NF Stage 15

NF Stage 25

NF Stage 36

NF Stage 37

Cited Literature:
MicroRNA control of Nodal signalling.
Martello G et al. 2007
Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556