On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-15c
Mature Sequence: UAGCAGCACAUCAUGGUUUGUA
Full Sequence:
CUUUGAGGUG AUCUAGCAGC ACAUCAUGGU UUGUAGAAAC AAGGAGAUAC AGACCAUUCU GAGCUGCCUC
Mirbase: MI0004892
In Situ Images:

NF Stage 15

NF Stage 25

NF Stage 36

NF Stage 37

Cited Literature:
MicroRNA control of Nodal signalling.
Martello G et al. 2007

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556