Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-16c
Mature Sequence: UAGCAGCACGUAAAUACUGGAG
Full Sequence:
UUUAGCAGCA CGUAAAUACU GGAGUUCAUG ACCAUAUCUG CACUCUCCAG UAUUACUUUG CUGCUAUAUU
Mirbase: MI0004801
In Situ Images:

NF Stage 26

NF Stage 36

Cited Literature:
MicroRNA control of Nodal signalling.
Martello G et al. 2007

My Xenbase: [ Log-in / Register ]
version: [4.7.1]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556