On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-18a*
Mature Sequence: ACUGCCCUAAGUGCUCCUUCU
Full Sequence:
GUGCUUUUUG UCCUAAGGUG CAUCUAGUGC AGAUAGUGAA GUAGAUUAGC AUCUACUGCC CUAAGUGCUC CUUCUGGCAU
Mirbase: MI0004893
In Situ Images:

NF Stage 24

NF Stage 32

NF Stage 40

NF Stage 44

Cited Literature:

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556