On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-196a
Mature Sequence: UAGGUAGUUUCAUGUUGUUG
Full Sequence:
UUUGUAUCCA GCUGAUCUGU GGUUUAGGUA GUUUCAUGUU GUUGGGAUUG CUUUUUCUUA ACGCGGCAAC AAGAAACUGC CUUAAUUACG UCAGUUCGUC
Mirbase: MI0004942
In Situ Images:

NF Stage 18

NF Stage 22

NF Stage 30

NF Stage 32

Cited Literature:
miRNPs: versatile regulators of gene expression in vertebrate cells.
Steitz JA et al. 2009
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005
Misexpression of miR-196a induces eye anomaly in Xenopus laevis.
Qiu R et al. 2009
The role of miR-124a in early development of the Xenopus eye.
Qiu R et al. 2009

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556