On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-199a*
Mature Sequence: UACAGUAGUCUGCACAUUGGUU
Full Sequence:
AAGAACCUGC UCCGUCGCCC CAGUGUUCAG ACUACCUGUU CAGGACAAUG CUGUUGUACA GUAGUCUGCA CAUUGGUUAG ACUGGGCAUG
Mirbase: MI0004859
In Situ Images:

NF Stage 18

Cited Literature:

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556