Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-200a
Mature Sequence: UAACACUGUCUGGUAACGAUGU
Full Sequence:
UGGUCCUCUA UGGACAUCUU ACUAGACAGU GCUGGAUUUA UUUUAUCUUU UCUAACACUG UCUGGUAACG AUGUUUAAAG
Mirbase: MI0004945
In Situ Images:

NF Stage 32

NF Stage 32

NF Stage 42

NF Stage 42

Cited Literature:
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008
miR-31 functions as a negative regulator of lymphatic vascular lineage-specific differentiation in vitro and vascular development in vivo.
Karpanen T et al. 2010

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556