Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-202
Mature Sequence: AGGGGCAUAGGGCAUGGGAAAA
Full Sequence:
Mirbase:
In Situ Images:

NF Stage 24

NF Stage 26

NF Stage 28

NF Stage 36

Cited Literature:
Testis-derived microRNA profiles of African clawed frogs (Xenopus) and their sterile hybrids.
Michalak P et al. 2008
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008

My Xenbase: [ Log-in / Register ]
version: [4.7.1]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556