Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-205b
Mature Sequence: UCCUUCAUUCCACCGGAUCCUG
Full Sequence:
UGCUGCUGUC CUUCAUUCCA CCGGAUCCUG UGUAAAUAUA AUCCAGAUUC CCAGUGGCAU GAAGUGCAUU
Mirbase: MI0004862
In Situ Images:

NF Stage 18

NF Stage 18

NF Stage 26

NF Stage 27

NF Stage 28

NF Stage 38

Cited Literature:

My Xenbase: [ Log-in / Register ]
version: [4.7.1]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556