Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-2188
Mature Sequence: AAGGUCCAGCCUCAUAUGUCCU
Full Sequence:
GGGCGUGUGG GAAAGGUCCA GCCUCAUAUG UCCUGUGAUC CUGAGGGGGA GAUAUGUGGU CAGACCUGUC CCACAGGCCG
Mirbase: MI0011554
In Situ Images:

NF Stage 11

NF Stage 18

NF Stage 24

NF Stage 26

NF Stage 28

NF Stage 28

NF Stage 38

Cited Literature:
Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis.
Armisen J et al. 2009
Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556