On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-302
Mature Sequence: UAAGUGCUCCAAUGUUUUAGUGG
Full Sequence:
CCCCACUACU UUAACAUUGG UGUACUUUCU AUGUCUUUAA AAAGGGUAAG UGCUCCAAUG
Mirbase: MI0004878
In Situ Images:

NF Stage 16

NF Stage 19

NF Stage 26

NF Stage 28

NF Stage 32

NF Stage 38

Cited Literature:
The miR-430/427/302 family controls mesendodermal fate specification via species-specific target selection.
Rosa A et al. 2009
Semiconserved regulation of mesendoderm differentiation by microRNAs.
Ketting RF .et al. 2009

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556