Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-302
Mature Sequence: UAAGUGCUCCAAUGUUUUAGUGG
Full Sequence:
CCCCACUACU UUAACAUUGG UGUACUUUCU AUGUCUUUAA AAAGGGUAAG UGCUCCAAUG
miRBase: MI0004878
In Situ Images:

NF Stage 16

NF Stage 19

NF Stage 26

NF Stage 28

NF Stage 32

NF Stage 38

Cited Literature:
The miR-430/427/302 family controls mesendodermal fate specification via species-specific target selection.
Rosa A et al. 2009
Semiconserved regulation of mesendoderm differentiation by microRNAs.
Ketting RF .et al. 2009
Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556